İK/Yeni Ekonomi Haberleri

İK YENİ EKONOMİ

    Bir insan yaratmak için ne kadar veri gerekli?

    Dilek DAYINLARLI
    26.05.2017 - 22:12 | Son Güncelleme:

    Doğa o kadar muhteşem bir şey ki; tüm bu veriyi aslında gözle hiç göremeyeceğimiz kadar küçücük bir kristal olan DNA’nın içine sıkıştırmış durumda.

    Bir insan yaratmak için ne kadar veri gerekliSevgili okurlarım, yakın geleceği değiştirecek en önemli teknolojiler arasında genetik ve biyoinformatik, sanal gerçeklik, artırılmış gerçeklik, sürücüsüz araçlar, makine öğrenimi (machine learning), yapay zekâ ve blockchain gibi teknolojiler yer alıyor.

    Bunlardan bir tanesi var ki insanın şifrelerini anlamamızı ve insanın hiç olmadığı kadar değişmesini sağlayacak: Genetik ve makine öğreniminin bir araya gelmesiyle ortaya çıkan Biyoinformatik.

    “Bir insan yaratmak için ne kadar veri gerekli” sorusunun yanıtını ararken, sanal bir verinin fiziksel dünyadaki görünümüyle daha iyi fikir vermesi açısından şu örnek üzerinden gidebiliriz: Bir insan oluşturmak için gereken veriyi USB belleklere koyduğumuzu düşünürsek, 2000 adet stadyumu dolduracak kadar USB bellek gerekiyor. Kısacası hamile bir kadın gördüğünüzde bebeği için dünyanın en büyük verisini yarattığına emin olabilirsiniz.

    Ama doğa o kadar muhteşem bir şey ki; tüm bu veriyi aslında gözle hiç göremeyeceğimiz kadar küçücük bir kristal olan DNA’nın içine sıkıştırmış durumda. Rosalind Franklin adında harika bir bilim kadınının fotoğrafını çekmesiyle DNA’yı ilk kez 1950’de gördük. Ancak bunu insan hücresinden çıkartıp, açmak ve veriyi okumak tam 40 yıl aldı.

    DNA’nın alfabesi aslında sadece 4 harften oluşuyor: A, C, T ve G. Bir insanı yaratmak için ise bu harflerden tam 3 milyar adete ihtiyaç var. İlk verisi çıkartılan insan genomunu kitap haline getirsek aşağıdaki gibi devam eden ansiklopedilerce satır göreceğiz.

    “AACCAATGACTGACGTAACC”
    Bu arada 3 milyar adet harfin aslında yüzde 99.9’luk kısmı tüm insanlarda aynı. Yani o kadar da farklı değiliz... Geri kalan o küçücük kısım ise bizi farklı kılan kısım.

    Yine fiziksel dünyadan bir örnek verecek olursak; eğer bu veri kitapta olsaydı, herkesin kitabı aynı paragraf ve bölümü aynı sırada olurdu. Her kitap neredeyse aynı hikayeyi anlatırdı. Ancak benim kitabım belki 600. sayfada dil bilgisi hatası veya sizin kitabınız 101. sayfada bambaşka bir dil kullanmış olabilirdi. Bu denli yakınız birbirimize.

    Hatta kafanızı biraz daha karıştırayım ve CRISPR’dan bahsedeyim. CRISPR, DNA’nızı düzenlemenize yarayan yeni metodun adı. Kısaca sizin datalarınızı içeren kitapta gidip istediğiniz değişikliği yapmanızı sağlıyor.

    İnsan geni verisinin maliyeti düşüyor
    2003 yılında tamamlanan ilk insan geni verisinin çıkartılması işlemi 3 milyar dolara mal olmuştu. Bugün bir insan geni verisinin maliyeti 1,000 doların altına iniyor ve ortaya inanılmaz bir veri çıkıyor.

    Mevcutta bu verinin sadece yüzde 2’sini anlamlandırabiliyoruz ve daha gidecek çok yolumuz var. Peki ne demek bunların hepsi? Yani insan genetik verisinin ucuzlaması, makine öğrenimi ile bu veriyi anlamanın daha hızlanması?

    Teknoloji ve inovasyon yatırımcısı olarak her zaman düşünürüm: “Hangi yarattığımız teknoloji, internet kadar hatta daha fazla dünyayı değiştirecek?”

    Günümüzde Dünya Sağlık Örgütü’ne göre 7500 hastalık mevcut. İlaç şirketleri, görülme sayısı az olduğundan bunlardan sadece 500 tanesi için ilaç üretiyor. Genetik dataları anlamamız arttıkça kişiye özel ve çözümler üretebileceğiz. Günümüzün en kötü hastalığı olan kansere çare bulabileceğiz. Tabi yapacak çok iş var birçok bilim insanına ihtiyacımız var.

    Türkiye’nin ise dünyada bu konuda özel bir yeri var. Üç kıtanın kesişim noktası olarak inanılmaz bir genetik çeşitliliğimiz mevcut. Bir de üzerine yüzde 25-30 oranında bir takım gelenekler yüzünden ortaya çıkan genetik farklılıklar bulunuyor. Bu da dünyada çözüm arayanlar için inanılmaz zengin bir veri sağlıyor.

    Genetiğin veri ile birleşmesi, makine öğrenimi ile anlamlandırılması ve değiştirilebilmesi, daha fazlasını da yapabileceğine ikna etti beni. Türkiye’de bu konuda çalışan inanılmaz girişimciler var. Bunlardan birine inanmış biri olarak şunu net söyleyebilirim; kızımı bugün bir mesleğe yönlendirsem mutlaka bu alan olurdu.

    Etiketler:
    

    EN ÇOK OKUNANLAR

      Sayfa Başı